ID: 900834080

View in Genome Browser
Species Human (GRCh38)
Location 1:4986485-4986507
Sequence CAGCAGAGGTTACCTTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900834076_900834080 25 Left 900834076 1:4986437-4986459 CCATTTTTCATGGCCTCGACAAG No data
Right 900834080 1:4986485-4986507 CAGCAGAGGTTACCTTGAGCAGG No data
900834077_900834080 12 Left 900834077 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
Right 900834080 1:4986485-4986507 CAGCAGAGGTTACCTTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900834080 Original CRISPR CAGCAGAGGTTACCTTGAGC AGG Intergenic
No off target data available for this crispr