ID: 900834083

View in Genome Browser
Species Human (GRCh38)
Location 1:4986501-4986523
Sequence GAGCAGGGACCACAGACCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900834077_900834083 28 Left 900834077 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
Right 900834083 1:4986501-4986523 GAGCAGGGACCACAGACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900834083 Original CRISPR GAGCAGGGACCACAGACCAC CGG Intergenic
No off target data available for this crispr