ID: 900835298

View in Genome Browser
Species Human (GRCh38)
Location 1:4998705-4998727
Sequence GCCTGAAGTCAGGTGCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900835298_900835307 27 Left 900835298 1:4998705-4998727 CCTGACAGCACCTGACTTCAGGC No data
Right 900835307 1:4998755-4998777 CAGCGTTCACTGAAGCCCACTGG No data
900835298_900835308 28 Left 900835298 1:4998705-4998727 CCTGACAGCACCTGACTTCAGGC No data
Right 900835308 1:4998756-4998778 AGCGTTCACTGAAGCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900835298 Original CRISPR GCCTGAAGTCAGGTGCTGTC AGG (reversed) Intergenic
No off target data available for this crispr