ID: 900835299

View in Genome Browser
Species Human (GRCh38)
Location 1:4998715-4998737
Sequence TGTTCTGTGGGCCTGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900835299_900835309 22 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835309 1:4998760-4998782 TTCACTGAAGCCCACTGGGATGG No data
900835299_900835308 18 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835308 1:4998756-4998778 AGCGTTCACTGAAGCCCACTGGG No data
900835299_900835312 25 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835312 1:4998763-4998785 ACTGAAGCCCACTGGGATGGGGG 0: 1
1: 0
2: 0
3: 21
4: 229
900835299_900835310 23 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835310 1:4998761-4998783 TCACTGAAGCCCACTGGGATGGG No data
900835299_900835307 17 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835307 1:4998755-4998777 CAGCGTTCACTGAAGCCCACTGG No data
900835299_900835311 24 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835311 1:4998762-4998784 CACTGAAGCCCACTGGGATGGGG 0: 1
1: 0
2: 1
3: 16
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900835299 Original CRISPR TGTTCTGTGGGCCTGAAGTC AGG (reversed) Intergenic