ID: 900835300

View in Genome Browser
Species Human (GRCh38)
Location 1:4998727-4998749
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900835300_900835307 5 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835307 1:4998755-4998777 CAGCGTTCACTGAAGCCCACTGG No data
900835300_900835308 6 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835308 1:4998756-4998778 AGCGTTCACTGAAGCCCACTGGG No data
900835300_900835310 11 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835310 1:4998761-4998783 TCACTGAAGCCCACTGGGATGGG No data
900835300_900835309 10 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835309 1:4998760-4998782 TTCACTGAAGCCCACTGGGATGG No data
900835300_900835312 13 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835312 1:4998763-4998785 ACTGAAGCCCACTGGGATGGGGG 0: 1
1: 0
2: 0
3: 21
4: 229
900835300_900835311 12 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835311 1:4998762-4998784 CACTGAAGCCCACTGGGATGGGG 0: 1
1: 0
2: 1
3: 16
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900835300 Original CRISPR GGAAGTTCGAGGTGTTCTGT GGG (reversed) Intergenic