ID: 900835301

View in Genome Browser
Species Human (GRCh38)
Location 1:4998728-4998750
Sequence TGGAAGTTCGAGGTGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900835301_900835311 11 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835311 1:4998762-4998784 CACTGAAGCCCACTGGGATGGGG No data
900835301_900835310 10 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835310 1:4998761-4998783 TCACTGAAGCCCACTGGGATGGG No data
900835301_900835309 9 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835309 1:4998760-4998782 TTCACTGAAGCCCACTGGGATGG No data
900835301_900835307 4 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835307 1:4998755-4998777 CAGCGTTCACTGAAGCCCACTGG No data
900835301_900835312 12 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835312 1:4998763-4998785 ACTGAAGCCCACTGGGATGGGGG No data
900835301_900835308 5 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835308 1:4998756-4998778 AGCGTTCACTGAAGCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900835301 Original CRISPR TGGAAGTTCGAGGTGTTCTG TGG (reversed) Intergenic