ID: 900835303

View in Genome Browser
Species Human (GRCh38)
Location 1:4998748-4998770
Sequence GCTTCAGTGAACGCTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900835303_900835310 -10 Left 900835303 1:4998748-4998770 CCATCCCCAGCGTTCACTGAAGC No data
Right 900835310 1:4998761-4998783 TCACTGAAGCCCACTGGGATGGG No data
900835303_900835312 -8 Left 900835303 1:4998748-4998770 CCATCCCCAGCGTTCACTGAAGC No data
Right 900835312 1:4998763-4998785 ACTGAAGCCCACTGGGATGGGGG No data
900835303_900835311 -9 Left 900835303 1:4998748-4998770 CCATCCCCAGCGTTCACTGAAGC No data
Right 900835311 1:4998762-4998784 CACTGAAGCCCACTGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900835303 Original CRISPR GCTTCAGTGAACGCTGGGGA TGG (reversed) Intergenic