ID: 900835307

View in Genome Browser
Species Human (GRCh38)
Location 1:4998755-4998777
Sequence CAGCGTTCACTGAAGCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900835299_900835307 17 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835307 1:4998755-4998777 CAGCGTTCACTGAAGCCCACTGG No data
900835301_900835307 4 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835307 1:4998755-4998777 CAGCGTTCACTGAAGCCCACTGG No data
900835298_900835307 27 Left 900835298 1:4998705-4998727 CCTGACAGCACCTGACTTCAGGC No data
Right 900835307 1:4998755-4998777 CAGCGTTCACTGAAGCCCACTGG No data
900835302_900835307 -6 Left 900835302 1:4998738-4998760 CCTCGAACTTCCATCCCCAGCGT No data
Right 900835307 1:4998755-4998777 CAGCGTTCACTGAAGCCCACTGG No data
900835300_900835307 5 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835307 1:4998755-4998777 CAGCGTTCACTGAAGCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900835307 Original CRISPR CAGCGTTCACTGAAGCCCAC TGG Intergenic
No off target data available for this crispr