ID: 900835308

View in Genome Browser
Species Human (GRCh38)
Location 1:4998756-4998778
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900835299_900835308 18 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835308 1:4998756-4998778 AGCGTTCACTGAAGCCCACTGGG No data
900835300_900835308 6 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835308 1:4998756-4998778 AGCGTTCACTGAAGCCCACTGGG No data
900835301_900835308 5 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835308 1:4998756-4998778 AGCGTTCACTGAAGCCCACTGGG No data
900835302_900835308 -5 Left 900835302 1:4998738-4998760 CCTCGAACTTCCATCCCCAGCGT No data
Right 900835308 1:4998756-4998778 AGCGTTCACTGAAGCCCACTGGG No data
900835298_900835308 28 Left 900835298 1:4998705-4998727 CCTGACAGCACCTGACTTCAGGC No data
Right 900835308 1:4998756-4998778 AGCGTTCACTGAAGCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr