ID: 900835309

View in Genome Browser
Species Human (GRCh38)
Location 1:4998760-4998782
Sequence TTCACTGAAGCCCACTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900835302_900835309 -1 Left 900835302 1:4998738-4998760 CCTCGAACTTCCATCCCCAGCGT No data
Right 900835309 1:4998760-4998782 TTCACTGAAGCCCACTGGGATGG No data
900835300_900835309 10 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835309 1:4998760-4998782 TTCACTGAAGCCCACTGGGATGG No data
900835299_900835309 22 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835309 1:4998760-4998782 TTCACTGAAGCCCACTGGGATGG No data
900835301_900835309 9 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835309 1:4998760-4998782 TTCACTGAAGCCCACTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900835309 Original CRISPR TTCACTGAAGCCCACTGGGA TGG Intergenic