ID: 900835310

View in Genome Browser
Species Human (GRCh38)
Location 1:4998761-4998783
Sequence TCACTGAAGCCCACTGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900835299_900835310 23 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835310 1:4998761-4998783 TCACTGAAGCCCACTGGGATGGG No data
900835300_900835310 11 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835310 1:4998761-4998783 TCACTGAAGCCCACTGGGATGGG No data
900835302_900835310 0 Left 900835302 1:4998738-4998760 CCTCGAACTTCCATCCCCAGCGT No data
Right 900835310 1:4998761-4998783 TCACTGAAGCCCACTGGGATGGG No data
900835301_900835310 10 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835310 1:4998761-4998783 TCACTGAAGCCCACTGGGATGGG No data
900835303_900835310 -10 Left 900835303 1:4998748-4998770 CCATCCCCAGCGTTCACTGAAGC No data
Right 900835310 1:4998761-4998783 TCACTGAAGCCCACTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900835310 Original CRISPR TCACTGAAGCCCACTGGGAT GGG Intergenic