ID: 900835312

View in Genome Browser
Species Human (GRCh38)
Location 1:4998763-4998785
Sequence ACTGAAGCCCACTGGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900835299_900835312 25 Left 900835299 1:4998715-4998737 CCTGACTTCAGGCCCACAGAACA No data
Right 900835312 1:4998763-4998785 ACTGAAGCCCACTGGGATGGGGG No data
900835300_900835312 13 Left 900835300 1:4998727-4998749 CCCACAGAACACCTCGAACTTCC No data
Right 900835312 1:4998763-4998785 ACTGAAGCCCACTGGGATGGGGG No data
900835301_900835312 12 Left 900835301 1:4998728-4998750 CCACAGAACACCTCGAACTTCCA No data
Right 900835312 1:4998763-4998785 ACTGAAGCCCACTGGGATGGGGG No data
900835303_900835312 -8 Left 900835303 1:4998748-4998770 CCATCCCCAGCGTTCACTGAAGC No data
Right 900835312 1:4998763-4998785 ACTGAAGCCCACTGGGATGGGGG No data
900835302_900835312 2 Left 900835302 1:4998738-4998760 CCTCGAACTTCCATCCCCAGCGT No data
Right 900835312 1:4998763-4998785 ACTGAAGCCCACTGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900835312 Original CRISPR ACTGAAGCCCACTGGGATGG GGG Intergenic