ID: 900836989

View in Genome Browser
Species Human (GRCh38)
Location 1:5012617-5012639
Sequence TTGTATTTGCATAAGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900836984_900836989 14 Left 900836984 1:5012580-5012602 CCATTTTCTATCATTTTATTCAC No data
Right 900836989 1:5012617-5012639 TTGTATTTGCATAAGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900836989 Original CRISPR TTGTATTTGCATAAGGAAGG GGG Intergenic
No off target data available for this crispr