ID: 900838998

View in Genome Browser
Species Human (GRCh38)
Location 1:5032183-5032205
Sequence ACAGGTAAGCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900838998_900839009 12 Left 900838998 1:5032183-5032205 CCCTCTTCCCTCTGCTTACCTGT No data
Right 900839009 1:5032218-5032240 TGGGAATCTGGGAAGCCAACAGG No data
900838998_900839002 -8 Left 900838998 1:5032183-5032205 CCCTCTTCCCTCTGCTTACCTGT No data
Right 900839002 1:5032198-5032220 TTACCTGTACACCAGACCTTTGG No data
900838998_900839006 1 Left 900838998 1:5032183-5032205 CCCTCTTCCCTCTGCTTACCTGT No data
Right 900839006 1:5032207-5032229 CACCAGACCTTTGGGAATCTGGG No data
900838998_900839005 0 Left 900838998 1:5032183-5032205 CCCTCTTCCCTCTGCTTACCTGT No data
Right 900839005 1:5032206-5032228 ACACCAGACCTTTGGGAATCTGG No data
900838998_900839003 -7 Left 900838998 1:5032183-5032205 CCCTCTTCCCTCTGCTTACCTGT No data
Right 900839003 1:5032199-5032221 TACCTGTACACCAGACCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900838998 Original CRISPR ACAGGTAAGCAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr