ID: 900844076

View in Genome Browser
Species Human (GRCh38)
Location 1:5082218-5082240
Sequence GCCCATTTGCTGCTGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900844074_900844076 -3 Left 900844074 1:5082198-5082220 CCTGCTTGAACACCTTAAGGGCC No data
Right 900844076 1:5082218-5082240 GCCCATTTGCTGCTGTTCTCAGG No data
900844071_900844076 9 Left 900844071 1:5082186-5082208 CCAATATTGGATCCTGCTTGAAC No data
Right 900844076 1:5082218-5082240 GCCCATTTGCTGCTGTTCTCAGG No data
900844070_900844076 16 Left 900844070 1:5082179-5082201 CCTAACACCAATATTGGATCCTG No data
Right 900844076 1:5082218-5082240 GCCCATTTGCTGCTGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900844076 Original CRISPR GCCCATTTGCTGCTGTTCTC AGG Intergenic
No off target data available for this crispr