ID: 900854271

View in Genome Browser
Species Human (GRCh38)
Location 1:5168206-5168228
Sequence CTTTTATGTGTATATAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900854271_900854274 0 Left 900854271 1:5168206-5168228 CCCAAGTTATATACACATAAAAG No data
Right 900854274 1:5168229-5168251 TGACTAAAGGAAATTCCAGCTGG No data
900854271_900854279 14 Left 900854271 1:5168206-5168228 CCCAAGTTATATACACATAAAAG No data
Right 900854279 1:5168243-5168265 TCCAGCTGGGGGGCAAATACTGG No data
900854271_900854281 22 Left 900854271 1:5168206-5168228 CCCAAGTTATATACACATAAAAG No data
Right 900854281 1:5168251-5168273 GGGGGCAAATACTGGCTTCAAGG No data
900854271_900854282 23 Left 900854271 1:5168206-5168228 CCCAAGTTATATACACATAAAAG No data
Right 900854282 1:5168252-5168274 GGGGCAAATACTGGCTTCAAGGG No data
900854271_900854276 2 Left 900854271 1:5168206-5168228 CCCAAGTTATATACACATAAAAG No data
Right 900854276 1:5168231-5168253 ACTAAAGGAAATTCCAGCTGGGG No data
900854271_900854278 4 Left 900854271 1:5168206-5168228 CCCAAGTTATATACACATAAAAG No data
Right 900854278 1:5168233-5168255 TAAAGGAAATTCCAGCTGGGGGG No data
900854271_900854277 3 Left 900854271 1:5168206-5168228 CCCAAGTTATATACACATAAAAG No data
Right 900854277 1:5168232-5168254 CTAAAGGAAATTCCAGCTGGGGG No data
900854271_900854275 1 Left 900854271 1:5168206-5168228 CCCAAGTTATATACACATAAAAG No data
Right 900854275 1:5168230-5168252 GACTAAAGGAAATTCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900854271 Original CRISPR CTTTTATGTGTATATAACTT GGG (reversed) Intergenic
No off target data available for this crispr