ID: 900854272

View in Genome Browser
Species Human (GRCh38)
Location 1:5168207-5168229
Sequence ACTTTTATGTGTATATAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900854272_900854274 -1 Left 900854272 1:5168207-5168229 CCAAGTTATATACACATAAAAGT No data
Right 900854274 1:5168229-5168251 TGACTAAAGGAAATTCCAGCTGG No data
900854272_900854275 0 Left 900854272 1:5168207-5168229 CCAAGTTATATACACATAAAAGT No data
Right 900854275 1:5168230-5168252 GACTAAAGGAAATTCCAGCTGGG No data
900854272_900854277 2 Left 900854272 1:5168207-5168229 CCAAGTTATATACACATAAAAGT No data
Right 900854277 1:5168232-5168254 CTAAAGGAAATTCCAGCTGGGGG No data
900854272_900854282 22 Left 900854272 1:5168207-5168229 CCAAGTTATATACACATAAAAGT No data
Right 900854282 1:5168252-5168274 GGGGCAAATACTGGCTTCAAGGG No data
900854272_900854276 1 Left 900854272 1:5168207-5168229 CCAAGTTATATACACATAAAAGT No data
Right 900854276 1:5168231-5168253 ACTAAAGGAAATTCCAGCTGGGG No data
900854272_900854281 21 Left 900854272 1:5168207-5168229 CCAAGTTATATACACATAAAAGT No data
Right 900854281 1:5168251-5168273 GGGGGCAAATACTGGCTTCAAGG No data
900854272_900854283 30 Left 900854272 1:5168207-5168229 CCAAGTTATATACACATAAAAGT No data
Right 900854283 1:5168260-5168282 TACTGGCTTCAAGGGCATCCTGG No data
900854272_900854279 13 Left 900854272 1:5168207-5168229 CCAAGTTATATACACATAAAAGT No data
Right 900854279 1:5168243-5168265 TCCAGCTGGGGGGCAAATACTGG No data
900854272_900854278 3 Left 900854272 1:5168207-5168229 CCAAGTTATATACACATAAAAGT No data
Right 900854278 1:5168233-5168255 TAAAGGAAATTCCAGCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900854272 Original CRISPR ACTTTTATGTGTATATAACT TGG (reversed) Intergenic
No off target data available for this crispr