ID: 900854279

View in Genome Browser
Species Human (GRCh38)
Location 1:5168243-5168265
Sequence TCCAGCTGGGGGGCAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900854271_900854279 14 Left 900854271 1:5168206-5168228 CCCAAGTTATATACACATAAAAG No data
Right 900854279 1:5168243-5168265 TCCAGCTGGGGGGCAAATACTGG No data
900854270_900854279 15 Left 900854270 1:5168205-5168227 CCCCAAGTTATATACACATAAAA No data
Right 900854279 1:5168243-5168265 TCCAGCTGGGGGGCAAATACTGG No data
900854272_900854279 13 Left 900854272 1:5168207-5168229 CCAAGTTATATACACATAAAAGT No data
Right 900854279 1:5168243-5168265 TCCAGCTGGGGGGCAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900854279 Original CRISPR TCCAGCTGGGGGGCAAATAC TGG Intergenic
No off target data available for this crispr