ID: 900859434

View in Genome Browser
Species Human (GRCh38)
Location 1:5217632-5217654
Sequence AGGGAGAAGCAGACTTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900859434_900859443 19 Left 900859434 1:5217632-5217654 CCCTCCAAAGTCTGCTTCTCCCT No data
Right 900859443 1:5217674-5217696 AATAGAGCTGCTGCTAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900859434 Original CRISPR AGGGAGAAGCAGACTTTGGA GGG (reversed) Intergenic
No off target data available for this crispr