ID: 900859443

View in Genome Browser
Species Human (GRCh38)
Location 1:5217674-5217696
Sequence AATAGAGCTGCTGCTAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900859433_900859443 28 Left 900859433 1:5217623-5217645 CCTTTGGGTCCCTCCAAAGTCTG No data
Right 900859443 1:5217674-5217696 AATAGAGCTGCTGCTAACTCAGG No data
900859437_900859443 15 Left 900859437 1:5217636-5217658 CCAAAGTCTGCTTCTCCCTGGTC No data
Right 900859443 1:5217674-5217696 AATAGAGCTGCTGCTAACTCAGG No data
900859435_900859443 18 Left 900859435 1:5217633-5217655 CCTCCAAAGTCTGCTTCTCCCTG No data
Right 900859443 1:5217674-5217696 AATAGAGCTGCTGCTAACTCAGG No data
900859440_900859443 -10 Left 900859440 1:5217661-5217683 CCCCACGCTAATTAATAGAGCTG No data
Right 900859443 1:5217674-5217696 AATAGAGCTGCTGCTAACTCAGG No data
900859434_900859443 19 Left 900859434 1:5217632-5217654 CCCTCCAAAGTCTGCTTCTCCCT No data
Right 900859443 1:5217674-5217696 AATAGAGCTGCTGCTAACTCAGG No data
900859438_900859443 0 Left 900859438 1:5217651-5217673 CCCTGGTCTTCCCCACGCTAATT No data
Right 900859443 1:5217674-5217696 AATAGAGCTGCTGCTAACTCAGG No data
900859439_900859443 -1 Left 900859439 1:5217652-5217674 CCTGGTCTTCCCCACGCTAATTA No data
Right 900859443 1:5217674-5217696 AATAGAGCTGCTGCTAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900859443 Original CRISPR AATAGAGCTGCTGCTAACTC AGG Intergenic
No off target data available for this crispr