ID: 900862429

View in Genome Browser
Species Human (GRCh38)
Location 1:5243108-5243130
Sequence CCTGGTCACCAGCCCTCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900862418_900862429 10 Left 900862418 1:5243075-5243097 CCCTTCCTGGTGCCTTTCTGCCG No data
Right 900862429 1:5243108-5243130 CCTGGTCACCAGCCCTCGAAAGG No data
900862419_900862429 9 Left 900862419 1:5243076-5243098 CCTTCCTGGTGCCTTTCTGCCGT No data
Right 900862429 1:5243108-5243130 CCTGGTCACCAGCCCTCGAAAGG No data
900862422_900862429 -2 Left 900862422 1:5243087-5243109 CCTTTCTGCCGTTGCCCCTGGCC No data
Right 900862429 1:5243108-5243130 CCTGGTCACCAGCCCTCGAAAGG No data
900862420_900862429 5 Left 900862420 1:5243080-5243102 CCTGGTGCCTTTCTGCCGTTGCC No data
Right 900862429 1:5243108-5243130 CCTGGTCACCAGCCCTCGAAAGG No data
900862424_900862429 -10 Left 900862424 1:5243095-5243117 CCGTTGCCCCTGGCCTGGTCACC No data
Right 900862429 1:5243108-5243130 CCTGGTCACCAGCCCTCGAAAGG No data
900862417_900862429 18 Left 900862417 1:5243067-5243089 CCACAGATCCCTTCCTGGTGCCT No data
Right 900862429 1:5243108-5243130 CCTGGTCACCAGCCCTCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900862429 Original CRISPR CCTGGTCACCAGCCCTCGAA AGG Intergenic
No off target data available for this crispr