ID: 900865529

View in Genome Browser
Species Human (GRCh38)
Location 1:5266218-5266240
Sequence GTGTTAGGGATCCCGAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900865524_900865529 2 Left 900865524 1:5266193-5266215 CCCAGAGTGGCGGAAGAGCTGTG No data
Right 900865529 1:5266218-5266240 GTGTTAGGGATCCCGAGCAGAGG No data
900865522_900865529 6 Left 900865522 1:5266189-5266211 CCCACCCAGAGTGGCGGAAGAGC No data
Right 900865529 1:5266218-5266240 GTGTTAGGGATCCCGAGCAGAGG No data
900865523_900865529 5 Left 900865523 1:5266190-5266212 CCACCCAGAGTGGCGGAAGAGCT No data
Right 900865529 1:5266218-5266240 GTGTTAGGGATCCCGAGCAGAGG No data
900865519_900865529 21 Left 900865519 1:5266174-5266196 CCTAGAAAGTGGCAGCCCACCCA No data
Right 900865529 1:5266218-5266240 GTGTTAGGGATCCCGAGCAGAGG No data
900865525_900865529 1 Left 900865525 1:5266194-5266216 CCAGAGTGGCGGAAGAGCTGTGG No data
Right 900865529 1:5266218-5266240 GTGTTAGGGATCCCGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900865529 Original CRISPR GTGTTAGGGATCCCGAGCAG AGG Intergenic