ID: 900868011

View in Genome Browser
Species Human (GRCh38)
Location 1:5282601-5282623
Sequence CTGTGGGTCTGTGGGTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900867998_900868011 25 Left 900867998 1:5282553-5282575 CCCCCAGAGCCGTGTGACAAGAC No data
Right 900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG No data
900867997_900868011 30 Left 900867997 1:5282548-5282570 CCAAACCCCCAGAGCCGTGTGAC No data
Right 900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG No data
900868001_900868011 22 Left 900868001 1:5282556-5282578 CCAGAGCCGTGTGACAAGACATT No data
Right 900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG No data
900868000_900868011 23 Left 900868000 1:5282555-5282577 CCCAGAGCCGTGTGACAAGACAT No data
Right 900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG No data
900868002_900868011 16 Left 900868002 1:5282562-5282584 CCGTGTGACAAGACATTTCTGTT No data
Right 900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG No data
900867999_900868011 24 Left 900867999 1:5282554-5282576 CCCCAGAGCCGTGTGACAAGACA No data
Right 900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900868011 Original CRISPR CTGTGGGTCTGTGGGTCTGT GGG Intergenic
No off target data available for this crispr