ID: 900870395

View in Genome Browser
Species Human (GRCh38)
Location 1:5298078-5298100
Sequence GTGTCATCCTACCATGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900870395_900870403 23 Left 900870395 1:5298078-5298100 CCAGTCACATGGTAGGATGACAC No data
Right 900870403 1:5298124-5298146 GTGGTGCTGTGTTACTGGCCTGG No data
900870395_900870398 4 Left 900870395 1:5298078-5298100 CCAGTCACATGGTAGGATGACAC No data
Right 900870398 1:5298105-5298127 CCATGCCCCTTGCAGTTGAGTGG No data
900870395_900870402 18 Left 900870395 1:5298078-5298100 CCAGTCACATGGTAGGATGACAC No data
Right 900870402 1:5298119-5298141 GTTGAGTGGTGCTGTGTTACTGG No data
900870395_900870404 30 Left 900870395 1:5298078-5298100 CCAGTCACATGGTAGGATGACAC No data
Right 900870404 1:5298131-5298153 TGTGTTACTGGCCTGGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900870395 Original CRISPR GTGTCATCCTACCATGTGAC TGG (reversed) Intergenic
No off target data available for this crispr