ID: 900872185

View in Genome Browser
Species Human (GRCh38)
Location 1:5312019-5312041
Sequence GGTGGGGGATACTCCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900872185_900872195 18 Left 900872185 1:5312019-5312041 CCCACAGAGGAGTATCCCCCACC No data
Right 900872195 1:5312060-5312082 AGCTCTCAGTGACCCCGGACTGG No data
900872185_900872194 13 Left 900872185 1:5312019-5312041 CCCACAGAGGAGTATCCCCCACC No data
Right 900872194 1:5312055-5312077 GGCTCAGCTCTCAGTGACCCCGG No data
900872185_900872188 -8 Left 900872185 1:5312019-5312041 CCCACAGAGGAGTATCCCCCACC No data
Right 900872188 1:5312034-5312056 CCCCCACCGCGCAGTTCACCTGG No data
900872185_900872198 30 Left 900872185 1:5312019-5312041 CCCACAGAGGAGTATCCCCCACC No data
Right 900872198 1:5312072-5312094 CCCCGGACTGGGATCTTGTGTGG No data
900872185_900872196 19 Left 900872185 1:5312019-5312041 CCCACAGAGGAGTATCCCCCACC No data
Right 900872196 1:5312061-5312083 GCTCTCAGTGACCCCGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900872185 Original CRISPR GGTGGGGGATACTCCTCTGT GGG (reversed) Intergenic
No off target data available for this crispr