ID: 900873891

View in Genome Browser
Species Human (GRCh38)
Location 1:5327441-5327463
Sequence CTCTGGACACTGATGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900873891_900873897 12 Left 900873891 1:5327441-5327463 CCCCTGAGCATCAGTGTCCAGAG No data
Right 900873897 1:5327476-5327498 CTTCATTACATATACATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900873891 Original CRISPR CTCTGGACACTGATGCTCAG GGG (reversed) Intergenic
No off target data available for this crispr