ID: 900873921

View in Genome Browser
Species Human (GRCh38)
Location 1:5327654-5327676
Sequence TAATATGTATACAACATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900873921_900873922 -6 Left 900873921 1:5327654-5327676 CCTGTCATGTTGTATACATATTA No data
Right 900873922 1:5327671-5327693 ATATTACTTTCCAGAAATTGAGG No data
900873921_900873924 13 Left 900873921 1:5327654-5327676 CCTGTCATGTTGTATACATATTA No data
Right 900873924 1:5327690-5327712 GAGGACCAAACCACTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900873921 Original CRISPR TAATATGTATACAACATGAC AGG (reversed) Intergenic
No off target data available for this crispr