ID: 900873922

View in Genome Browser
Species Human (GRCh38)
Location 1:5327671-5327693
Sequence ATATTACTTTCCAGAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900873920_900873922 -3 Left 900873920 1:5327651-5327673 CCTCCTGTCATGTTGTATACATA No data
Right 900873922 1:5327671-5327693 ATATTACTTTCCAGAAATTGAGG No data
900873919_900873922 14 Left 900873919 1:5327634-5327656 CCATGCTAAACAAACATCCTCCT No data
Right 900873922 1:5327671-5327693 ATATTACTTTCCAGAAATTGAGG No data
900873918_900873922 21 Left 900873918 1:5327627-5327649 CCAGCAGCCATGCTAAACAAACA No data
Right 900873922 1:5327671-5327693 ATATTACTTTCCAGAAATTGAGG No data
900873921_900873922 -6 Left 900873921 1:5327654-5327676 CCTGTCATGTTGTATACATATTA No data
Right 900873922 1:5327671-5327693 ATATTACTTTCCAGAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900873922 Original CRISPR ATATTACTTTCCAGAAATTG AGG Intergenic
No off target data available for this crispr