ID: 900873924

View in Genome Browser
Species Human (GRCh38)
Location 1:5327690-5327712
Sequence GAGGACCAAACCACTCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900873920_900873924 16 Left 900873920 1:5327651-5327673 CCTCCTGTCATGTTGTATACATA No data
Right 900873924 1:5327690-5327712 GAGGACCAAACCACTCTCTCTGG No data
900873921_900873924 13 Left 900873921 1:5327654-5327676 CCTGTCATGTTGTATACATATTA No data
Right 900873924 1:5327690-5327712 GAGGACCAAACCACTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900873924 Original CRISPR GAGGACCAAACCACTCTCTC TGG Intergenic
No off target data available for this crispr