ID: 900874728

View in Genome Browser
Species Human (GRCh38)
Location 1:5333679-5333701
Sequence CCTCCACTCTTTAAAGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900874728_900874736 22 Left 900874728 1:5333679-5333701 CCAACCACTTTAAAGAGTGGAGG No data
Right 900874736 1:5333724-5333746 ATGTCTTCTGCAGGGAACAGGGG No data
900874728_900874731 13 Left 900874728 1:5333679-5333701 CCAACCACTTTAAAGAGTGGAGG No data
Right 900874731 1:5333715-5333737 ATCATCTCCATGTCTTCTGCAGG No data
900874728_900874732 14 Left 900874728 1:5333679-5333701 CCAACCACTTTAAAGAGTGGAGG No data
Right 900874732 1:5333716-5333738 TCATCTCCATGTCTTCTGCAGGG No data
900874728_900874735 21 Left 900874728 1:5333679-5333701 CCAACCACTTTAAAGAGTGGAGG No data
Right 900874735 1:5333723-5333745 CATGTCTTCTGCAGGGAACAGGG No data
900874728_900874734 20 Left 900874728 1:5333679-5333701 CCAACCACTTTAAAGAGTGGAGG No data
Right 900874734 1:5333722-5333744 CCATGTCTTCTGCAGGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900874728 Original CRISPR CCTCCACTCTTTAAAGTGGT TGG (reversed) Intergenic
No off target data available for this crispr