ID: 900876529

View in Genome Browser
Species Human (GRCh38)
Location 1:5346679-5346701
Sequence GAATTTAAACTAATGTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900876526_900876529 11 Left 900876526 1:5346645-5346667 CCATATTGCATTGTTGCTTCTGG No data
Right 900876529 1:5346679-5346701 GAATTTAAACTAATGTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900876529 Original CRISPR GAATTTAAACTAATGTTTCA TGG Intergenic
No off target data available for this crispr