ID: 900877105

View in Genome Browser
Species Human (GRCh38)
Location 1:5350629-5350651
Sequence CATTTGAAGGAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900877099_900877105 5 Left 900877099 1:5350601-5350623 CCAAAGACTTCTGAACATCAGAT No data
Right 900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG No data
900877098_900877105 17 Left 900877098 1:5350589-5350611 CCTGGTACATAGCCAAAGACTTC No data
Right 900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900877105 Original CRISPR CATTTGAAGGAGAAGGTGGA GGG Intergenic
No off target data available for this crispr