ID: 900878366

View in Genome Browser
Species Human (GRCh38)
Location 1:5362590-5362612
Sequence GAGCCACTTGCTATTGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900878362_900878366 14 Left 900878362 1:5362553-5362575 CCTGTACTTGTGGCATATCCTGT No data
Right 900878366 1:5362590-5362612 GAGCCACTTGCTATTGTGACTGG No data
900878365_900878366 -4 Left 900878365 1:5362571-5362593 CCTGTAGGCTGAGCATCAGGAGC No data
Right 900878366 1:5362590-5362612 GAGCCACTTGCTATTGTGACTGG No data
900878361_900878366 17 Left 900878361 1:5362550-5362572 CCACCTGTACTTGTGGCATATCC No data
Right 900878366 1:5362590-5362612 GAGCCACTTGCTATTGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900878366 Original CRISPR GAGCCACTTGCTATTGTGAC TGG Intergenic
No off target data available for this crispr