ID: 900879473 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:5370334-5370356 |
| Sequence | AAATAATCAAACCAACTTTT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 900879473_900879476 | 8 | Left | 900879473 | 1:5370334-5370356 | CCCAAAAGTTGGTTTGATTATTT | No data | ||
| Right | 900879476 | 1:5370365-5370387 | TGAATATGCAAACAAACAATGGG | No data | ||||
| 900879473_900879475 | 7 | Left | 900879473 | 1:5370334-5370356 | CCCAAAAGTTGGTTTGATTATTT | No data | ||
| Right | 900879475 | 1:5370364-5370386 | CTGAATATGCAAACAAACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 900879473 | Original CRISPR | AAATAATCAAACCAACTTTT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||