ID: 900879475

View in Genome Browser
Species Human (GRCh38)
Location 1:5370364-5370386
Sequence CTGAATATGCAAACAAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900879473_900879475 7 Left 900879473 1:5370334-5370356 CCCAAAAGTTGGTTTGATTATTT No data
Right 900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG No data
900879474_900879475 6 Left 900879474 1:5370335-5370357 CCAAAAGTTGGTTTGATTATTTT No data
Right 900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900879475 Original CRISPR CTGAATATGCAAACAAACAA TGG Intergenic
No off target data available for this crispr