ID: 900880507

View in Genome Browser
Species Human (GRCh38)
Location 1:5377971-5377993
Sequence TCAGGGGGCTCTGGCTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900880496_900880507 19 Left 900880496 1:5377929-5377951 CCTGGGAACTGGGAAAGCAAATG No data
Right 900880507 1:5377971-5377993 TCAGGGGGCTCTGGCTGGTGGGG No data
900880492_900880507 30 Left 900880492 1:5377918-5377940 CCAGTGGCCGTCCTGGGAACTGG No data
Right 900880507 1:5377971-5377993 TCAGGGGGCTCTGGCTGGTGGGG No data
900880495_900880507 23 Left 900880495 1:5377925-5377947 CCGTCCTGGGAACTGGGAAAGCA No data
Right 900880507 1:5377971-5377993 TCAGGGGGCTCTGGCTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900880507 Original CRISPR TCAGGGGGCTCTGGCTGGTG GGG Intergenic
No off target data available for this crispr