ID: 900880658

View in Genome Browser
Species Human (GRCh38)
Location 1:5378911-5378933
Sequence CTCAGTAAGCTAAAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900880656_900880658 -1 Left 900880656 1:5378889-5378911 CCAACATTCATTTTTGATAAAAC No data
Right 900880658 1:5378911-5378933 CTCAGTAAGCTAAAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900880658 Original CRISPR CTCAGTAAGCTAAAAATGGA AGG Intergenic
No off target data available for this crispr