ID: 900882387

View in Genome Browser
Species Human (GRCh38)
Location 1:5391419-5391441
Sequence TGCCTCCTCAACGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900882387_900882399 19 Left 900882387 1:5391419-5391441 CCTCAGCCTCCGTTGAGGAGGCA No data
Right 900882399 1:5391461-5391483 ACCAGCTTCTCTTTGTCTCCGGG No data
900882387_900882395 -7 Left 900882387 1:5391419-5391441 CCTCAGCCTCCGTTGAGGAGGCA No data
Right 900882395 1:5391435-5391457 GGAGGCAAGGGGGCCAGGCATGG No data
900882387_900882401 20 Left 900882387 1:5391419-5391441 CCTCAGCCTCCGTTGAGGAGGCA No data
Right 900882401 1:5391462-5391484 CCAGCTTCTCTTTGTCTCCGGGG No data
900882387_900882402 28 Left 900882387 1:5391419-5391441 CCTCAGCCTCCGTTGAGGAGGCA No data
Right 900882402 1:5391470-5391492 TCTTTGTCTCCGGGGTTTAAAGG No data
900882387_900882403 29 Left 900882387 1:5391419-5391441 CCTCAGCCTCCGTTGAGGAGGCA No data
Right 900882403 1:5391471-5391493 CTTTGTCTCCGGGGTTTAAAGGG No data
900882387_900882396 -6 Left 900882387 1:5391419-5391441 CCTCAGCCTCCGTTGAGGAGGCA No data
Right 900882396 1:5391436-5391458 GAGGCAAGGGGGCCAGGCATGGG No data
900882387_900882398 18 Left 900882387 1:5391419-5391441 CCTCAGCCTCCGTTGAGGAGGCA No data
Right 900882398 1:5391460-5391482 AACCAGCTTCTCTTTGTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900882387 Original CRISPR TGCCTCCTCAACGGAGGCTG AGG (reversed) Intergenic
No off target data available for this crispr