ID: 900883417

View in Genome Browser
Species Human (GRCh38)
Location 1:5398709-5398731
Sequence TGGGTTATCACTCAAGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900883405_900883417 28 Left 900883405 1:5398658-5398680 CCCCAGCTTGTGAATGAGAGGCA No data
Right 900883417 1:5398709-5398731 TGGGTTATCACTCAAGGGGTAGG No data
900883407_900883417 26 Left 900883407 1:5398660-5398682 CCAGCTTGTGAATGAGAGGCAGC No data
Right 900883417 1:5398709-5398731 TGGGTTATCACTCAAGGGGTAGG No data
900883406_900883417 27 Left 900883406 1:5398659-5398681 CCCAGCTTGTGAATGAGAGGCAG No data
Right 900883417 1:5398709-5398731 TGGGTTATCACTCAAGGGGTAGG No data
900883411_900883417 -6 Left 900883411 1:5398692-5398714 CCTCAAATGCCCAGCTCTGGGTT No data
Right 900883417 1:5398709-5398731 TGGGTTATCACTCAAGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900883417 Original CRISPR TGGGTTATCACTCAAGGGGT AGG Intergenic
No off target data available for this crispr