ID: 900884160

View in Genome Browser
Species Human (GRCh38)
Location 1:5403654-5403676
Sequence GTCTCTGGGCAACACTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900884160_900884175 25 Left 900884160 1:5403654-5403676 CCAGCCCAGTGTTGCCCAGAGAC No data
Right 900884175 1:5403702-5403724 CCAAGGCCATGAGACCCCTTAGG No data
900884160_900884170 1 Left 900884160 1:5403654-5403676 CCAGCCCAGTGTTGCCCAGAGAC No data
Right 900884170 1:5403678-5403700 CAGGGGAATCTCCCAGGGTCTGG No data
900884160_900884171 8 Left 900884160 1:5403654-5403676 CCAGCCCAGTGTTGCCCAGAGAC No data
Right 900884171 1:5403685-5403707 ATCTCCCAGGGTCTGGTCCAAGG No data
900884160_900884169 -4 Left 900884160 1:5403654-5403676 CCAGCCCAGTGTTGCCCAGAGAC No data
Right 900884169 1:5403673-5403695 AGACACAGGGGAATCTCCCAGGG No data
900884160_900884168 -5 Left 900884160 1:5403654-5403676 CCAGCCCAGTGTTGCCCAGAGAC No data
Right 900884168 1:5403672-5403694 GAGACACAGGGGAATCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900884160 Original CRISPR GTCTCTGGGCAACACTGGGC TGG (reversed) Intergenic
No off target data available for this crispr