ID: 900884885

View in Genome Browser
Species Human (GRCh38)
Location 1:5408103-5408125
Sequence ACCAAAAGTGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900884882_900884885 -1 Left 900884882 1:5408081-5408103 CCACTCCCTAGGTGTTGTGACAA No data
Right 900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG No data
900884881_900884885 2 Left 900884881 1:5408078-5408100 CCTCCACTCCCTAGGTGTTGTGA No data
Right 900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG No data
900884883_900884885 -6 Left 900884883 1:5408086-5408108 CCCTAGGTGTTGTGACAACCAAA No data
Right 900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG No data
900884884_900884885 -7 Left 900884884 1:5408087-5408109 CCTAGGTGTTGTGACAACCAAAA No data
Right 900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG No data
900884878_900884885 27 Left 900884878 1:5408053-5408075 CCTCTACCTACTAAGTGCTCATA No data
Right 900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG No data
900884879_900884885 21 Left 900884879 1:5408059-5408081 CCTACTAAGTGCTCATATTCCTC No data
Right 900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900884885 Original CRISPR ACCAAAAGTGTCTCCAGACA TGG Intergenic
No off target data available for this crispr