ID: 900886820

View in Genome Browser
Species Human (GRCh38)
Location 1:5421118-5421140
Sequence CCAGTGATGGAAGCTCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900886820_900886824 2 Left 900886820 1:5421118-5421140 CCTTGGTGAGCTTCCATCACTGG No data
Right 900886824 1:5421143-5421165 TGCATGCCTCCTTATCATGGAGG No data
900886820_900886827 13 Left 900886820 1:5421118-5421140 CCTTGGTGAGCTTCCATCACTGG No data
Right 900886827 1:5421154-5421176 TTATCATGGAGGATTCCCAGAGG No data
900886820_900886823 -1 Left 900886820 1:5421118-5421140 CCTTGGTGAGCTTCCATCACTGG No data
Right 900886823 1:5421140-5421162 GAATGCATGCCTCCTTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900886820 Original CRISPR CCAGTGATGGAAGCTCACCA AGG (reversed) Intergenic
No off target data available for this crispr