ID: 900886823

View in Genome Browser
Species Human (GRCh38)
Location 1:5421140-5421162
Sequence GAATGCATGCCTCCTTATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900886818_900886823 7 Left 900886818 1:5421110-5421132 CCCGGTCTCCTTGGTGAGCTTCC No data
Right 900886823 1:5421140-5421162 GAATGCATGCCTCCTTATCATGG No data
900886819_900886823 6 Left 900886819 1:5421111-5421133 CCGGTCTCCTTGGTGAGCTTCCA No data
Right 900886823 1:5421140-5421162 GAATGCATGCCTCCTTATCATGG No data
900886820_900886823 -1 Left 900886820 1:5421118-5421140 CCTTGGTGAGCTTCCATCACTGG No data
Right 900886823 1:5421140-5421162 GAATGCATGCCTCCTTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900886823 Original CRISPR GAATGCATGCCTCCTTATCA TGG Intergenic
No off target data available for this crispr