ID: 900887127

View in Genome Browser
Species Human (GRCh38)
Location 1:5423082-5423104
Sequence GTGGCAGGTGGGAGACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900887127_900887133 15 Left 900887127 1:5423082-5423104 CCAGGCTGTCTCCCACCTGCCAC No data
Right 900887133 1:5423120-5423142 AATCGAGAGTGATAGCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900887127 Original CRISPR GTGGCAGGTGGGAGACAGCC TGG (reversed) Intergenic
No off target data available for this crispr