ID: 900892514

View in Genome Browser
Species Human (GRCh38)
Location 1:5459712-5459734
Sequence TGGTGCAGCCAGGGTCTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900892510_900892514 -8 Left 900892510 1:5459697-5459719 CCTCACCGTAAGTATTGGTGCAG No data
Right 900892514 1:5459712-5459734 TGGTGCAGCCAGGGTCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900892514 Original CRISPR TGGTGCAGCCAGGGTCTGAT AGG Intergenic
No off target data available for this crispr