ID: 900893334

View in Genome Browser
Species Human (GRCh38)
Location 1:5465447-5465469
Sequence CTAGTACAGAACCTCTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900893334_900893338 -6 Left 900893334 1:5465447-5465469 CCATTAGAGAGGTTCTGTACTAG No data
Right 900893338 1:5465464-5465486 TACTAGGGGCCAGAGCACGTAGG No data
900893334_900893339 2 Left 900893334 1:5465447-5465469 CCATTAGAGAGGTTCTGTACTAG No data
Right 900893339 1:5465472-5465494 GCCAGAGCACGTAGGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900893334 Original CRISPR CTAGTACAGAACCTCTCTAA TGG (reversed) Intergenic
No off target data available for this crispr