ID: 900894321

View in Genome Browser
Species Human (GRCh38)
Location 1:5472830-5472852
Sequence ACAGATAAGTAAACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900894316_900894321 -1 Left 900894316 1:5472808-5472830 CCTTTGTCATTATCCCCATTTTA No data
Right 900894321 1:5472830-5472852 ACAGATAAGTAAACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900894321 Original CRISPR ACAGATAAGTAAACTGTGGA AGG Intergenic
No off target data available for this crispr