ID: 900897988

View in Genome Browser
Species Human (GRCh38)
Location 1:5497237-5497259
Sequence TTGTGGCCCTTGAAGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900897988_900897992 -6 Left 900897988 1:5497237-5497259 CCCTCATCCTTCAAGGGCCACAA No data
Right 900897992 1:5497254-5497276 CCACAACCCTTCAATATTCCTGG No data
900897988_900897995 -3 Left 900897988 1:5497237-5497259 CCCTCATCCTTCAAGGGCCACAA No data
Right 900897995 1:5497257-5497279 CAACCCTTCAATATTCCTGGGGG No data
900897988_900897993 -5 Left 900897988 1:5497237-5497259 CCCTCATCCTTCAAGGGCCACAA No data
Right 900897993 1:5497255-5497277 CACAACCCTTCAATATTCCTGGG No data
900897988_900897994 -4 Left 900897988 1:5497237-5497259 CCCTCATCCTTCAAGGGCCACAA No data
Right 900897994 1:5497256-5497278 ACAACCCTTCAATATTCCTGGGG No data
900897988_900897999 13 Left 900897988 1:5497237-5497259 CCCTCATCCTTCAAGGGCCACAA No data
Right 900897999 1:5497273-5497295 CTGGGGGTCCTTGCCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900897988 Original CRISPR TTGTGGCCCTTGAAGGATGA GGG (reversed) Intergenic
No off target data available for this crispr