ID: 900898148

View in Genome Browser
Species Human (GRCh38)
Location 1:5498244-5498266
Sequence CCTAGCATGGGGAGGGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900898148_900898156 -5 Left 900898148 1:5498244-5498266 CCACATTCCCTCCCCATGCTAGG No data
Right 900898156 1:5498262-5498284 CTAGGGTCTCCCAGTGTCTAAGG No data
900898148_900898157 2 Left 900898148 1:5498244-5498266 CCACATTCCCTCCCCATGCTAGG No data
Right 900898157 1:5498269-5498291 CTCCCAGTGTCTAAGGCGTTCGG No data
900898148_900898163 8 Left 900898148 1:5498244-5498266 CCACATTCCCTCCCCATGCTAGG No data
Right 900898163 1:5498275-5498297 GTGTCTAAGGCGTTCGGGGAGGG No data
900898148_900898166 19 Left 900898148 1:5498244-5498266 CCACATTCCCTCCCCATGCTAGG No data
Right 900898166 1:5498286-5498308 GTTCGGGGAGGGGACTAGGAAGG No data
900898148_900898158 3 Left 900898148 1:5498244-5498266 CCACATTCCCTCCCCATGCTAGG No data
Right 900898158 1:5498270-5498292 TCCCAGTGTCTAAGGCGTTCGGG No data
900898148_900898164 9 Left 900898148 1:5498244-5498266 CCACATTCCCTCCCCATGCTAGG No data
Right 900898164 1:5498276-5498298 TGTCTAAGGCGTTCGGGGAGGGG No data
900898148_900898162 7 Left 900898148 1:5498244-5498266 CCACATTCCCTCCCCATGCTAGG No data
Right 900898162 1:5498274-5498296 AGTGTCTAAGGCGTTCGGGGAGG No data
900898148_900898160 4 Left 900898148 1:5498244-5498266 CCACATTCCCTCCCCATGCTAGG No data
Right 900898160 1:5498271-5498293 CCCAGTGTCTAAGGCGTTCGGGG No data
900898148_900898165 15 Left 900898148 1:5498244-5498266 CCACATTCCCTCCCCATGCTAGG No data
Right 900898165 1:5498282-5498304 AGGCGTTCGGGGAGGGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900898148 Original CRISPR CCTAGCATGGGGAGGGAATG TGG (reversed) Intergenic
No off target data available for this crispr