ID: 900898281

View in Genome Browser
Species Human (GRCh38)
Location 1:5498880-5498902
Sequence CTGAGTCTTCCTTGTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900898281_900898286 -3 Left 900898281 1:5498880-5498902 CCCCCAAAACAAGGAAGACTCAG No data
Right 900898286 1:5498900-5498922 CAGACTTGCTAGCAAACAGAGGG No data
900898281_900898285 -4 Left 900898281 1:5498880-5498902 CCCCCAAAACAAGGAAGACTCAG No data
Right 900898285 1:5498899-5498921 TCAGACTTGCTAGCAAACAGAGG No data
900898281_900898292 25 Left 900898281 1:5498880-5498902 CCCCCAAAACAAGGAAGACTCAG No data
Right 900898292 1:5498928-5498950 GAGGAAACCAGGAACAGGGCAGG No data
900898281_900898287 6 Left 900898281 1:5498880-5498902 CCCCCAAAACAAGGAAGACTCAG No data
Right 900898287 1:5498909-5498931 TAGCAAACAGAGGGCACCAGAGG No data
900898281_900898288 14 Left 900898281 1:5498880-5498902 CCCCCAAAACAAGGAAGACTCAG No data
Right 900898288 1:5498917-5498939 AGAGGGCACCAGAGGAAACCAGG No data
900898281_900898289 20 Left 900898281 1:5498880-5498902 CCCCCAAAACAAGGAAGACTCAG No data
Right 900898289 1:5498923-5498945 CACCAGAGGAAACCAGGAACAGG No data
900898281_900898290 21 Left 900898281 1:5498880-5498902 CCCCCAAAACAAGGAAGACTCAG No data
Right 900898290 1:5498924-5498946 ACCAGAGGAAACCAGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900898281 Original CRISPR CTGAGTCTTCCTTGTTTTGG GGG (reversed) Intergenic
No off target data available for this crispr